bioinformatics - Querying NCBI for a sequence from ncbi via Biopython -

-

how can query ncbi sequences given chromosome's genbank identifier, , start , stop positions using biopython?

cp001665    napp    tile    6373    6422    .   +   .   cluster=9;  cp001665    napp    tile    6398    6447    .   +   .   cluster=3;  cp001665    napp    tile    6423    6472    .   +   .   cluster=3;  cp001665    napp    tile    6448    6497    .   +   .   cluster=3; cp001665    napp    tile    7036    7085    .   +   .   cluster=10;  cp001665    napp    tile    7061    7110    .   +   .   cluster=3;  cp001665    napp    tile    7073    7122    .   +   .   cluster=3; 

from bio import entrez bio import seqio  entrez.email = "sample@example.org"  handle = entrez.efetch(db="nuccore",                        id="cp001665",                        rettype="gb",                        retmode="text")  whole_sequence = seqio.read(handle, "genbank")  print whole_sequence[6373:6422]

once know id , database fetch from, use entrez.efetch handle file. should specify returning type (rettype="gb") , mode (retmode="text"), handler filelike data.

then pass handler seqio, should return seqrecord object. 1 nice feature of seqrecords can cleanly sliced lists. if can retrieve starting , ending points somewhere, above print statement returns:

id: cp001665.1 name: cp001665 description: escherichia coli 'bl21-gold(de3)plyss ag', complete genome. number of features: 0 seq('gcgctaaccatgcgagcgtgcctgatgcgctacgcttatcaggcctacg', iupacambiguousdna())

Comments

Post a Comment

Popular posts from this blog

sql server - MSSQL Text and Varchar(MAX) fields shown (MEMO) in DBGrid -

-
Image
i have encountered problem in mssql & delphi xe3. text , varchar(max) fields seemed (memo) or (widememo) in tdbgrid & tdbadvgrid (tms dbgrid). in first screenshot can see table fiels, in second screentshot can see sample data in database: in screenshot, see how in dbgrid or in query results. i figured out changing field type char , varchar not max solves issue don't know why having problem. can please let me know?
Read more

php - Changing the visibility scope of parent methods in child classes -

-
i've got validator class , uservalidator class extends it. my validator has public method setrule(...) public visibility. when extend want change visibility of setrule(...) parent method private/protected within child it's visible child , no outsiders can call method from child. is possible? if so, how achieve it? from architectural point of view not recommended. stated in comments clean way set method protected children can access it. i cannot think of single use case put me in need call public method on parent class not allowed call on child class. that's against open/closed principle. classes should open extension, not modification. since not question i'll provide way how can achieved though. note: this method makes use of class responsible instantiation it's hack. solution not make use of php's native language features when throwing accessibility errors. first let's define classes had <?php class validator { ...
Read more

qml - Is it possible to implement SystemTrayIcon functionality in Qt Quick application -

-
i writing qtquick desktop application. use both c++ (for functionality) , qml (for ui) in it. use qquickview show interface written in qml. i want application reside in system tray when minimised. i mean functionality similar example. http://qt-project.org/doc/qt-4.8/desktop-systray.html . trying implement feature not find way in qt quick application. here main.cpp code: #include <qguiapplication> #include <qqmlengine> #include <qqmlcontext> #include <qqmlfileselector> #include <qquickview> #include "myapp.h" int main(int argc, char* argv[]) { qguiapplication app(argc,argv); app.setapplicationname(qfileinfo(app.applicationfilepath()).basename()); qdir::setcurrent(qapp->applicationdirpath()); myapp myappobject; qquickview view; view.connect(view.engine(), signal(quit()), &app, slot(quit())); view.rootcontext()->setcontextproperty("myappobject", &myappobject); new qqmlfilese...
Read more